glnA [2019-08-01 13:24:38]

glutamine synthetase, trigger enzyme

Locus: BSU_17460

Isoelectric point: 4.87

Molecular weight: 50.11 kDa

Protein length: 444 aa

Gene length: 1335 bp

Function: glutamine biosynthesis, control of TnrA and GlnR activity

Product: glutamine synthetase, trigger enzyme

Essential: no

E.C.: 6.3.1.2

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Information processing → Regulation of gene expression → Trigger enzyme → Trigger enzymes that control gene expression by protein-protein interaction with transcription factors
• Groups of genes → Phosphoproteins → Phosphorylation on either a Ser, Thr or Tyr residue

Gene

Coordinates: 1,878,425 1,879,759

Phenotypes of a mutant

• auxotrophic for glutamine

The protein

Catalyzed reaction/ biological activity

• ATP L-glutamate NH₃ = ADP phosphate L-glutamine (according to Swiss-Prot)

Protein family

• glutamine synthetase family (single member, according to UniProt)

Kinetic information

• K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 mol/min/mg

Domains

• glutamate binding flap (aa 300 ... 306: protects unstable intermediates from abberant hydrolysis)

Modification

• phosphorylated on ser/ thr/ tyr PubMed
• in vitro phosphorylated by PrkC on Thr-26, Thr-147, Ser-207, and Thr-286 PubMed

Cofactors

• Mg(2 )

Effectors of protein activity

• feedback inhibition by glutamine, glutamine binds the entrance site for glutamate
• activity is inhibited upon interaction with TnrA PubMed

Structure

• 4LNN (apo-GS) PubMed
• 3QAJ (complex with ATP)
• 4S0R (the TnrA-GlnA complex) PubMed
• [PDB|A general discussion of GS structure]

Localization

• cytoplasm (according to Swiss-Prot)

Additional information

• GlnA is a homooligomer of 12 subunits
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: glnR-glnA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • TnrA: repression, PubMed, in TnrA regulon
  • GlnR: repression, in complex with GlnA, in GlnR regulon

  Regulation

  • expressed in the absence of glutamine (GlnR) PubMed
  • the mRNA is processed between glnR and glnA by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed

• Genes: ynbA-ynbB-glnR-glnA
  Description: PubMed

  Regulation

  • the mRNA is processed between glnR and glnA by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed

• Genes: glnA
  Description: PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• GP247 (glnA::cat), available in Jörg Stülke's lab
• BKE17460 (glnA::ermC) (available at the BGSC and in Jörg Stülke's lab) PubMed
• GP2263 (glnA::ermC) (available in Jörg Stülke's lab)
• BP148 (del(glnR-glnA)::cat), available in Fabian Commichau's lab
• GP1883 (del(glnR-glnA)::ermC), available in Fabian Commichau's and Jörg Stülke's labs
• BKE17460 (glnA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
• BKK17460 (glnA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC

Expression vectors

• expression/ purification from E. coli, with N-terminal Strep-tag (in pGP172): pGP174, available in Jörg Stülke's lab
• pGP177 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pBQ200), available in Jörg Stülke's lab

LacZ fusion

• glnR-lacZ: pGP189 (in pAC7), available in Jörg Stülke's lab

Antibody

• available in Karl Forchhammer's lab

Labs working on this gene/protein

• Susan Fisher, Boston, USA homepage

References

Reviews

Loading

Original publications

Loading